Bismark

How to download the tool or source code including installation and usage instructions as well as any source code that might be associated with the executable. This should also include a listing of any dependencies for this tool or script.
- Download the bismark package from http://www.bioinformatics.bbsrc.ac.uk/projects/download.html to a directory.
- Extract the file using tar -xzvf filename
- Bismark requires Bowtie to be installed on your machine.

Required version of the program necessary to perform the desired task
- bismark v0.2.4

Sample dataset and expected results to be output

Excerpt from sample input files, chr8.fa (fasta file, reference sequence), and test_reads_bs.fq (fastq file, short reads)

chr8.fa:
>chr8
GCAATTATGACACAAAAAATTAAACAGTGCAGACTGATATATAAATCAAA
ACAAATGTCCTTTACATGTTTTCTGTTACAGTAGTAACAATATGTGTAAA
CTTAATTATCATATTTTTTTCTTGTGCTGTGGTTGTGTCCTGGGTTCATT
CTCTAAAATGCTGTTCACCTTAGACCAGGAGAAATATTAACCATACAGAC
TCTGTTTCAAGTCATAGCTGAATATTTTCAAAAGAGTGACTTTGTAAAAA
CATGTTCCAATGGCAAATTGATTCATTGTGATGGGATCAATTATTCCAAA
GACTTCTTGTCTTTATTTTGTTCCCATGCCTACCTTTTAGCCATAATACA

test_reads_bs.fq:
@chr8:144-169_1_0000000000000000000000000_0
TTTATTTTTTAAAATGTTGTTTATT
\+chr8:144-169_1_0000000000000000000000000_0
OhhhKhhhhLhhhhhhhhhhRhhhh
@chr8:440-465_1_0000000000000000000000000_0
TATAATGTTTTTTAAAATAAAAGAG
\+chr8:440-465_1_0000000000000000000000000_0
QhhhhhhhhhhhhOhHhhhhhhhhh
@chr8:1759-1784_0_0000000000000000000000000_0
TTGTAGGTTATTGAGGAAGGTGAGG
\+chr8:1759-1784_0_0000000000000000000000000_0
XhNh\[ZhhhhhhQThhKRhhhhhhh

Excerpt from sample output files, test_reads_bs.fq_bismark.txt, and CpG_context_test_reads_bs.fq_bismark.txt

Single-end output format (tab-separated):
1. <seq-ID>
2. <read alignment strand>
3. <chromosome>
4. <start position>
5. <end position>
6. <observed bisulfite sequence>
7. <equivalent genomic sequence>
8. <methylation call>
9. <read conversion
10. <genome conversion>

Paired-end output format (tab-separated):

<seq-ID>
<read 1 alignment strand>
<chromosome>
<start position>
<end position>
<observed bisulfite sequence 1>
<equivalent genomic sequence 1>
<methylation call 1>
<observed bisulfite sequence 2>
<equivalent genomic sequence 2>
<methylation call 2>
<read 1 conversion

test_reads_bs.fq_bismark.txt:
Bismark version: v0.2.4
chr8:144-169_1_0000000000000000000000000_0      +       chr8    145     169     TTTATTTTTTAAAATGTTGTTTATT       TTCATTCTCTAAAATGCTGTTCACCTT     ..h...h.h.......x....h.hh       CT      CT
chr8:440-465_1_0000000000000000000000000_0      +       chr8    441     465     TATAATGTTTTTTAAAATAAAAGAG       CACAATGCTTTCTAAAACAAAAGAGTC     h.h....h...h.....h.......       CT      CT

CpG_context_test_reads_bs.fq_bismark.txt:
Bismark methylation extractor version v0.2.4
chr8:3234-3259_0_0000000000000000000000000_0    -       chr8    3254    z
chr8:3577-3602_1_0000000000000000000000000_0    -       chr8    3579    z
chr8:1086-1111_1_0000000000000000000000000_0    -       chr8    1101    z
chr8:3216-3241_1_0000000000000000000000000_0    -       chr8    3231    z

Set of parameters and command line switches that match the expected execution of the tool including the possible command line definitions according to the occurrence of optional parameters. Also, validation instructions for parameters are requested.

Running the Bismark genome preparation

USAGE:

bismark_genome_preparation [options] <arguments>

OPTIONS:

parameter	brief description of the parameter	required	default value
--help/--man	Displays this help file	N	none
--verbose	Print verbose output for more details or debugging	N	none
--path_to_bowtie	The full path to the bowtie installation on your system	N	none
--yes/--yes_to_all	Answer yes to safety related questions	N	none

ARGUMENTS:

argument	brief description of the argument	required	default value	text, number, or file/path
path_to_genome_folder	The full path to the folder containing the genome to be bisulfite converted	Y	none	path

Running Bismark

USAGE:

bismark [options] <genome_folder> {-1 <mates1> -2 <mates2> | <singles>}

OPTIONS:

parameter	brief description of the parameter	required	default value	text, number, or file/path	description of validation rules
-q/--fastq	The query input files (specified as <mate1>,<mate2> or <singles> are FASTQ files	Y for FASTQ input	none
-f/--fasta	The query input files (specified as <mate1>,<mate2> or <singles> are FASTA files. All quality values are assumed to be 40 on the Phred scale	Y for FASTA input	none
-s/--skip	Skip the first <int> reads or read pairs from the input	N	0	integer	>=0
-u/--qupto	Only aligns the first <int> reads or read pairs from the input	N	none	integer	>=0
--phred33-quals	FASTQ qualities are ASCII chars equal to the Phred quality plus 33	N	Y
--phred64-quals	FASTQ qualities are ASCII chars equal to the Phred quality plus 64	N	N
--solexa-quals	Convert FASTQ qualities from solexa-scaled (which can be negative) to phred-scaled	N	N
--solexa1.3-quals	Same as --phred64-quals	N	N
--path_to_bowtie	The full path to the bowtie installation on your system	N	none
-n/--seedmms	The maximum number of mismatches permitted in the "seed" (see -l/--seedlen)	N	0	integer	0, 1, 2 or 3
-l/--seedlen	The "seed length"; i.e., the number of bases of the high quality end of the read to which the -n ceiling applies	N	28	integer	>=0
-e/--maqerr	Maximum permitted total of quality values at all mismatched read positions throughout the entire alignment, not just in the "seed"	N	70	integer	>=0
--chunkmbs	The number of megabytes of memory a given thread is given to store path descriptors in --best mode. Best-first search must keep track of many paths at once to ensure it is always extending the path with the lowest cumulative cost. Bowtie tries to minimize the memory impact of the descriptors, but they can still grow very large in some cases. If you receive an error message saying that chunk memory has been exhausted in --best mode, try adjusting this parameter up to dedicate more memory to the descriptors	N	64	integer	>=0
-I/--minins	The minimum insert size for valid paired-end alignments	N	0	integer	>=0
-X/--maxins	The maximum insert size for valid paired-end alignments	N	250	integer	>=0
--best	Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum	N	Y
--no_best	Disables the --best option which is on by default. This can speed up the alignment process, e.g. for testing purposes, but for credible results it is not recommended to disable --best	N	none
--directional	The user may specify if the sequencing library was constructed in a strand-specific manner. In this case the strands complementary to the original strands are merely theoretical and should not exist in reality. Thus, specifying --direction will only report alignments to the original top or bottom strands. This is the recommended option for sprand-specific libraries	N	none
--quiet	Print nothing besides alignments	N	none
-h/--help	Displays help file	N	none
-v/--version	Displays version information	N	none

ARGUMENTS:

argument	brief description of the argument	required	default value	text, number, or file/path
genome_folder	The full path to the folder containing the unmodified reference genome as well as the subfolders created by the Bismark_Genome_Preparation script	Y	none	path
-1	Comma-separated list of files containing the #1 mates	Y for paired-end read	none	files
-2	Comma-separated list of files containing the #2 mates	Y for paired-end read	none	files
singles	A comma-separated list of files containing the reads to be aligned	Y for single-end read	none	files

Running the methylation extractor

USAGE:

methylation_extractor [options] <filenames>

OPTIONS:

parameter	brief description of the parameter	required	default value	text, number, or file/path	description of validation rules
-s/--single-end	Input file(s) are Bismark result file(s) generated from single-end read data	Y for single-end read	none
-p/--paired-end	Input file(s) are Bismark result file(s) generated from paired-end read data	Y for paired-end read	none
--no_overlap	For paired-end reads it is theoretically possible that read_1 and read_2 overlap. This option avoids scoring overlapping methylation calls twice	N	none
--fasta	Chosing this option will print out the genomic sequences that correspond to the bisulfite mapped reads in FastA format	N	none
--ignore	Ignore the first <int> bp when processing the methylation call string	N	0	integer	>= 0
--comprehensive	Specifying this option will merge all four possible strand-specific methylation info into context-dependent output files	N	none
--merge_non_CpG	This will produce two output files (in --comprehensive mode) or eight strand-specific output files (default) for Cs in (i) CpG context (ii) any non-CpG context	N	none
--report	Prints out a short methylation summary and the paramaters used to run this script	N	none
--version	Displays version information	N	none
-h/--help	Displays this help file and exits	N	none

ARGUMENTS:

argument

brief description of the argument

required

default value

text, number, or file/path

filenames

A space-separated list of result files in Bismark format

Y

none

files

Example invocation of the command line application and its associated parameters such that it can perform an analysis

Running the Bismark genome preparation

~/bin/bismark_v0.2.4/bismark_genome_preparation --verbose --path_to_bowtie ~/bin/bowtie-0.12.7/ ~/sequence/test/

Running Bismark

single-end:
~/bin/bismark_v0.2.4/bismark -q --phred64-quals --path_to_bowtie ~/bin/bowtie-0.12.7/ -n 1 -l 20 ~/sequence/test/ test_reads_bs.fq
paired-end:
~/bin/bismark_v0.2.4/bismark -q --phred64-quals --path_to_bowtie ~/bin/bowtie-0.12.7/ -n 1 -l 20 -I 60 -X 350 ~/sequence/test/ -1 test_reads_bs1.fq -2 test_reads_bs2.fq

Running the methylation extractor

single-end:
~/bin/bismark_v0.2.4/methylation_extractor -s --comprehensive --report test_reads_bs.fq_bismark.txt
paired-end:
~/bin/bismark_v0.2.4/methylation_extractor -q --comprehensive --report test_reads_bs.fq_bismark.txt

How to download the tool or source code including installation and usage instructions as well as any source code that might be associated with the executable. This should also include a listing of any dependencies for this tool or script.

Required version of the program necessary to perform the desired task

Sample dataset and expected results to be output

Set of parameters and command line switches that match the expected execution of the tool including the possible command line definitions according to the occurrence of optional parameters. Also, validation instructions for parameters are requested.

Example invocation of the command line application and its associated parameters such that it can perform an analysis